Profile of regulator CD0683 in Clostridia-2
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | |
| Effector: | |
| Regulog: | CD0683 - Clostridia-2 |
Member of regulog collections
- By taxonomy - Clostridia-2
- By TF family - LacI
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Clostridium difficile 630 | |||||
| CD0679 | CD0679 | -119 | 6.1 | AAATGCATATGTATTCATAA | |
| CD0680 | CD0680 | -37 | 6.3 | TTATGCATACGTATTCTGAA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |