Regulog CD0683 - Clostridia-2

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:
Effector:
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes				Function

CRON 1.
CD0679	Clostridium bartlettii DSM 16795	* Clostridium difficile 630 Site: position = -119 score = 6.14191 sequence = AAATGCATATGTATTCATAA Gene: CD0679: Hypothetical protein	Clostridium hiranonis DSM 13275	Hypothetical protein

CRON 2.
CD0680	Clostridium bartlettii DSM 16795	* Clostridium difficile 630 Site: position = -37 score = 6.33563 sequence = TTATGCATACGTATTCTGAA Gene: CD0680: Hypothetical protein	Clostridium hiranonis DSM 13275	Hypothetical protein
CD0681	Clostridium bartlettii DSM 16795	Clostridium difficile 630 Gene: CD0681: Predicted transporter, MFS superfamily	Clostridium hiranonis DSM 13275	Predicted transporter, MFS superfamily
CD0682	Clostridium bartlettii DSM 16795	Clostridium difficile 630 Gene: CD0682: Putative sugar-sodium symporter	Clostridium hiranonis DSM 13275	Putative sugar-sodium symporter
CD0683	Clostridium bartlettii DSM 16795	Clostridium difficile 630 Gene: CD0683: Predicted transcriptional regulator, LacI family	Clostridium hiranonis DSM 13275	Predicted transcriptional regulator, LacI family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --