Regulon of Csal_3216 in Chromohalobacter salexigens DSM 3043

Properties
Regulator type:	Transcription factor
TF locus tag:	Csal_3216
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Csal_3216 - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -126 Score: 6.8 Sequence: ATCTGGTAGCGCTACCAATA Position: -84 Score: 7.3 Sequence: TTTTGGTAGCGCTACCAAAA Locus tag: Csal_3215 Name: Csal_3215 Funciton: Predicted sugar carboxylase Locus tag: Csal_3214 Name: Csal_3214 Funciton: TRAP transporterm, DctP subunit Locus tag: Csal_3213 Name: Csal_3213 Funciton: TRAP transporter, DctQ system Locus tag: Csal_3212 Name: Csal_3212 Funciton: TRAP transporter, DctM subunit Locus tag: Csal_3211 Name: Csal_3211 Funciton: Predicted NAD-dependent sugar epimerase/dehydratase
	Csal_3215	Csal_3215	Predicted sugar carboxylase
	Csal_3214	Csal_3214	TRAP transporterm, DctP subunit
	Csal_3213	Csal_3213	TRAP transporter, DctQ system
	Csal_3212	Csal_3212	TRAP transporter, DctM subunit
	Csal_3211	Csal_3211	Predicted NAD-dependent sugar epimerase/dehydratase
Position: -120 Score: 7.3 Sequence: TTTTGGTAGCGCTACCAAAA Position: -78 Score: 6.8 Sequence: TATTGGTAGCGCTACCAGAT Locus tag: Csal_3216 Name: Csal_3216 Funciton: Predicted transcriptional regulator, LacI family Locus tag: Csal_3217 Name: Csal_3217 Funciton: Hypothetical protein
	Csal_3216	Csal_3216	Predicted transcriptional regulator, LacI family
	Csal_3217	Csal_3217	Hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD