Profile of regulator Csal_3216 in Oceanospirillales/Alteromonadales

Properties
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Csal_3216 - Oceanospirillales/Alteromonadales

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By TF family - LacI
By pathway - Sugar utilization

Transcription factor binding sites

	Locus Tag	Name	Position	Score	Sequence
Chromohalobacter salexigens DSM 3043
	Csal_3216	Csal_3216	-120	7.3	TTTTGGTAGCGCTACCAAAA
	Csal_3216	Csal_3216	-78	6.8	TATTGGTAGCGCTACCAGAT
	Csal_3215	Csal_3215	-126	6.8	ATCTGGTAGCGCTACCAATA
	Csal_3215	Csal_3215	-84	7.3	TTTTGGTAGCGCTACCAAAA

Export
	Regulatory Sites	[ FASTA format ]	DOWNLOAD