Profile of regulator Csal_3216 in Oceanospirillales/Alteromonadales
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Regulog: | Csal_3216 - Oceanospirillales/Alteromonadales |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By TF family - LacI
- By pathway - Sugar utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Chromohalobacter salexigens DSM 3043 | |||||
| Csal_3216 | Csal_3216 | -120 | 7.3 | TTTTGGTAGCGCTACCAAAA | |
| Csal_3216 | Csal_3216 | -78 | 6.8 | TATTGGTAGCGCTACCAGAT | |
| Csal_3215 | Csal_3215 | -126 | 6.8 | ATCTGGTAGCGCTACCAATA | |
| Csal_3215 | Csal_3215 | -84 | 7.3 | TTTTGGTAGCGCTACCAAAA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |