Regulog Csal_3216 - Oceanospirillales/Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Cellvibrio japonicus Ueda107 | ||
| Teredinibacter turnerae T7901 | ||
| Saccharophagus degradans 2-40 | ||
| Marinobacter aqueolei | ||
| Marinobacter sp. ELB17 | ||
| Alcanivorax borkumensis SK2 | ||
| Chromohalobacter salexigens DSM 3043 | 7 | 2 |
| Hahella chejuensis KCTC 2396 | ||
| Marinomonas sp. MWYL1 | ||
| Oceanobacter sp. RED65 | ||
| Oceanospirillum sp. MED92 | ||
| Reinekea sp. MED297 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| Csal_3216 |
|
|
|
|
|
|
*
Chromohalobacter salexigens DSM 3043 Site: position = -120 score = 7.29043 sequence = TTTTGGTAGCGCTACCAAAA Site: position = -78 score = 6.77048 sequence = TATTGGTAGCGCTACCAGAT Gene: Csal_3216: Predicted transcriptional regulator, LacI family |
|
|
|
|
|
Predicted transcriptional regulator, LacI family |
| Csal_3217 |
|
|
|
|
|
|
Gene: Csal_3217: Hypothetical protein |
|
|
|
|
|
Hypothetical protein |
| CRON 2. | |||||||||||||
| Csal_3215 |
|
|
|
|
|
|
*
Chromohalobacter salexigens DSM 3043 Site: position = -126 score = 6.77048 sequence = ATCTGGTAGCGCTACCAATA Site: position = -84 score = 7.29043 sequence = TTTTGGTAGCGCTACCAAAA Gene: Csal_3215: Predicted sugar carboxylase |
|
|
|
|
|
Predicted sugar carboxylase |
| Csal_3214 |
|
|
|
|
Gene: MELB17_16323: TRAP transporterm, DctP subunit |
|
Gene: Csal_3214: TRAP transporterm, DctP subunit |
|
|
|
|
|
TRAP transporterm, DctP subunit |
| Csal_3213 |
|
|
|
|
Gene: MELB17_16318: TRAP transporter, DctQ system |
|
Gene: Csal_3213: TRAP transporter, DctQ system |
|
|
|
|
|
TRAP transporter, DctQ system |
| Csal_3212 |
|
|
|
|
Gene: MELB17_16313: TRAP transporter, DctM subunit |
|
Gene: Csal_3212: TRAP transporter, DctM subunit |
|
|
|
|
|
TRAP transporter, DctM subunit |
| Csal_3211 |
|
|
|
|
|
|
Gene: Csal_3211: Predicted NAD-dependent sugar epimerase/dehydratase |
|
|
|
|
|
Predicted NAD-dependent sugar epimerase/dehydratase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |