Regulon of PtsR in Enterobacter sp. 638

Properties
Regulator type:	Transcription factor
TF locus tag:	Ent638_0983
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	PtsR - Enterobacteriales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -75 Score: 7 Sequence: TAAGTAGAACGTTCTACTAA Position: -62 Score: 6.5 Sequence: CTACTAAAACGTTCTACTTA Locus tag: Ent638_0984 Name: ptsS Funciton: Sugar-specific PTS, IICBA component (EC 2.7.1.69) Locus tag: Ent638_0983 Name: ptsR Funciton: Transcriptional regulator of uncharcterized sugar PTS system, LacI family
	Ent638_0984	ptsS	Sugar-specific PTS, IICBA component (EC 2.7.1.69)
	Ent638_0983	ptsR	Transcriptional regulator of uncharcterized sugar PTS system, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD