Regulog PtsR - Enterobacteriales

Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - LacI
- By pathway - Sugar utilization
Genome | Genes | Operons |
---|---|---|
Citrobacter koseri ATCC BAA-895 | ||
Edwardsiella tarda EIB202 | ||
Enterobacter sp. 638 | 2 | 1 |
Erwinia amylovora ATCC 49946 | ||
Erwinia carotovora subsp. atroseptica SCRI1043 | ||
Escherichia coli str. K-12 substr. MG1655 | ||
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||
Photorhabdus luminescens subsp. laumondii TTO1 | ||
Proteus mirabilis HI4320 | ||
Salmonella typhimurium LT2 | ||
Serratia proteamaculans 568 | ||
Yersinia pestis KIM |
Genes | Function | ||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CRON 1. | |||||||||||||
ptsS |
|
|
*
Enterobacter sp. 638 Site: position = -75 score = 7.02065 sequence = TAAGTAGAACGTTCTACTAA Site: position = -62 score = 6.45344 sequence = CTACTAAAACGTTCTACTTA Gene: Ent638_0984: Sugar-specific PTS, IICBA component (EC 2.7.1.69) |
|
|
|
|
|
|
|
|
|
Sugar-specific PTS, IICBA component (EC 2.7.1.69) |
ptsR |
|
|
Gene: Ent638_0983: Transcriptional regulator of uncharcterized sugar PTS system, LacI family |
|
|
|
|
|
|
|
|
|
Transcriptional regulator of uncharcterized sugar PTS system, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |