Profile of regulator PtsR in Enterobacteriales
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Regulog: | PtsR - Enterobacteriales |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - LacI
- By pathway - Sugar utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Enterobacter sp. 638 | |||||
| Ent638_0984 | ptsS | -75 | 7 | TAAGTAGAACGTTCTACTAA | |
| Ent638_0984 | ptsS | -62 | 6.5 | CTACTAAAACGTTCTACTTA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |