Regulon of BglR in Yersinia pestis KIM

Properties
Regulator type:	Transcription factor
TF locus tag:	y3567
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside
Regulog:	BglR - Enterobacteriales
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - Beta-glucoside
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -62 Score: 6.7 Sequence: TTATAGAAACGTTTCTATTG Locus tag: y3570 Name: PF10091 Funciton: Six-hairpin glycosidase-like protein
	y3570	PF10091	Six-hairpin glycosidase-like protein
Position: -34 Score: 6.6 Sequence: CTAGTGAAACGTTTCTATTG Locus tag: y3569 Name: bglD Funciton: Predicted beta-glucoside ABC transport system, ATP-binding subunit Locus tag: y3568 Name: cbpA Funciton: Cellobiose phosphorylase (EC 2.4.1.-) Locus tag: y3567 Name: bglR Funciton: Transcriptional regulator for beta-glucoside utilization, LacI family Locus tag: y3566 Name: bglA Funciton: Predicted beta-glucoside ABC transport system, sugar-binding protein Locus tag: y3565 Name: bglB Funciton: Predicted beta-glucoside ABC transport system, permease protein 1 Locus tag: y3564 Name: bglC Funciton: Predicted beta-glucoside ABC transport system, permease protein 2 Locus tag: y3563 Name: y3563 Funciton: Putative exported protein precursor Locus tag: y3562 Name: bglX Funciton: Beta-glucosidase (EC 3.2.1.21)
	y3569	bglD	Predicted beta-glucoside ABC transport system, ATP-binding subunit
	y3568	cbpA	Cellobiose phosphorylase (EC 2.4.1.-)
	y3567	bglR	Transcriptional regulator for beta-glucoside utilization, LacI family
	y3566	bglA	Predicted beta-glucoside ABC transport system, sugar-binding protein
	y3565	bglB	Predicted beta-glucoside ABC transport system, permease protein 1
	y3564	bglC	Predicted beta-glucoside ABC transport system, permease protein 2
	y3563	y3563	Putative exported protein precursor
	y3562	bglX	Beta-glucosidase (EC 3.2.1.21)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD