Regulog BglR - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - LacI
- By effector - Beta-glucoside
- By pathway - Beta-glucosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||
| Edwardsiella tarda EIB202 | ||
| Enterobacter sp. 638 | ||
| Erwinia amylovora ATCC 49946 | ||
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||
| Escherichia coli str. K-12 substr. MG1655 | ||
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||
| Photorhabdus luminescens subsp. laumondii TTO1 | ||
| Proteus mirabilis HI4320 | ||
| Salmonella typhimurium LT2 | ||
| Serratia proteamaculans 568 | ||
| Yersinia pestis KIM | 9 | 2 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| bglD |
|
|
|
|
|
|
|
|
|
|
|
*
Yersinia pestis KIM Site: position = -34 score = 6.58587 sequence = CTAGTGAAACGTTTCTATTG Gene: y3569: Predicted beta-glucoside ABC transport system, ATP-binding subunit |
Predicted beta-glucoside ABC transport system, ATP-binding subunit |
| cbpA |
|
|
|
|
|
|
|
|
|
|
|
Gene: y3568: Cellobiose phosphorylase (EC 2.4.1.-) |
Cellobiose phosphorylase (EC 2.4.1.-) |
| bglR |
|
|
|
|
|
|
|
|
|
|
|
Gene: y3567: Transcriptional regulator for beta-glucoside utilization, LacI family |
Transcriptional regulator for beta-glucoside utilization, LacI family |
| bglA |
|
|
|
|
|
|
|
|
|
|
|
Gene: y3566: Predicted beta-glucoside ABC transport system, sugar-binding protein |
Predicted beta-glucoside ABC transport system, sugar-binding protein |
| bglB |
|
|
|
|
|
|
|
|
|
|
|
Gene: y3565: Predicted beta-glucoside ABC transport system, permease protein 1 |
Predicted beta-glucoside ABC transport system, permease protein 1 |
| bglC |
|
|
|
|
|
|
|
|
|
|
|
Gene: y3564: Predicted beta-glucoside ABC transport system, permease protein 2 |
Predicted beta-glucoside ABC transport system, permease protein 2 |
| y3563 |
|
|
|
|
|
|
|
|
|
|
|
Gene: y3563: Putative exported protein precursor |
Putative exported protein precursor |
| bglX |
|
|
|
|
|
|
|
|
|
|
|
Gene: y3562: Beta-glucosidase (EC 3.2.1.21) |
Beta-glucosidase (EC 3.2.1.21) |
| CRON 2. | |||||||||||||
| PF10091 |
|
|
|
|
|
|
|
|
|
|
|
*
Yersinia pestis KIM Site: position = -62 score = 6.72892 sequence = TTATAGAAACGTTTCTATTG Gene: y3570: Six-hairpin glycosidase-like protein |
Six-hairpin glycosidase-like protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |