Profile of regulator BglR in Enterobacteriales
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside |
| Regulog: | BglR - Enterobacteriales |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - LacI
- By effector - Beta-glucoside
- By pathway - Beta-glucosides utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Yersinia pestis KIM | |||||
| y3570 | PF10091 | -62 | 6.7 | TTATAGAAACGTTTCTATTG | |
| y3569 | bglD | -34 | 6.6 | CTAGTGAAACGTTTCTATTG | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |