Regulon of ABC1167 in Bacillus clausii KSM-K16

Properties
Regulator type:	Transcription factor
TF locus tag:	ABC1167
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	ABC1167 - Bacillales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -71 Score: 6.7 Sequence: CATTGCATACGTATGCAAAT Position: -35 Score: 6.8 Sequence: TTTTGAATACGTATGCAAGA Locus tag: ABC1168 Name: ABC1168 Funciton: Putative dehydrogenase Locus tag: ABC1167 Name: ABC1167 Funciton: Predicted transcriptional regulator, LacI family Locus tag: ABC1166 Name: gntT Funciton: Gluconate transporter
	ABC1168	ABC1168	Putative dehydrogenase
	ABC1167	ABC1167	Predicted transcriptional regulator, LacI family
	ABC1166	gntT	Gluconate transporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD