Profile of regulator ABC1167 in Bacillales
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Regulog: | ABC1167 - Bacillales |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - LacI
- By pathway - Sugar utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Bacillus clausii KSM-K16 | |||||
| ABC1168 | ABC1168 | -35 | 6.8 | TTTTGAATACGTATGCAAGA | |
| ABC1168 | ABC1168 | -71 | 6.7 | CATTGCATACGTATGCAAAT | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |