Regulog ABC1167 - Bacillales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Anoxybacillus flavithermus WK1
Bacillus amyloliquefaciens FZB42
Bacillus cereus ATCC 14579
Bacillus clausii KSM-K16	3	1
Bacillus halodurans C-125
Bacillus licheniformis DSM 13
Bacillus pumilus SAFR-032
Bacillus subtilis subsp. subtilis str. 168
Geobacillus kaustophilus HTA426
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
ABC1168	Anoxybacillus flavithermus WK1	Bacillus amyloliquefaciens FZB42	Bacillus cereus ATCC 14579	* Bacillus clausii KSM-K16 Site: position = -35 score = 6.78073 sequence = TTTTGAATACGTATGCAAGA Site: position = -71 score = 6.73701 sequence = CATTGCATACGTATGCAAAT Gene: ABC1168: Putative dehydrogenase	Bacillus halodurans C-125	Bacillus licheniformis DSM 13	Bacillus pumilus SAFR-032	Bacillus subtilis subsp. subtilis str. 168	Geobacillus kaustophilus HTA426	Oceanobacillus iheyensis HTE831	Paenibacillus sp. JDR-2	Putative dehydrogenase
ABC1167	Anoxybacillus flavithermus WK1	Bacillus amyloliquefaciens FZB42	Bacillus cereus ATCC 14579	Bacillus clausii KSM-K16 Gene: ABC1167: Predicted transcriptional regulator, LacI family	Bacillus halodurans C-125	Bacillus licheniformis DSM 13	Bacillus pumilus SAFR-032	Bacillus subtilis subsp. subtilis str. 168	Geobacillus kaustophilus HTA426	Oceanobacillus iheyensis HTE831	Paenibacillus sp. JDR-2	Predicted transcriptional regulator, LacI family
gntT	Anoxybacillus flavithermus WK1	Bacillus amyloliquefaciens FZB42	Bacillus cereus ATCC 14579	Bacillus clausii KSM-K16 Gene: ABC1166: Gluconate transporter	Bacillus halodurans C-125	Bacillus licheniformis DSM 13	Bacillus pumilus SAFR-032	Bacillus subtilis subsp. subtilis str. 168	Geobacillus kaustophilus HTA426	Oceanobacillus iheyensis HTE831	Paenibacillus sp. JDR-2	Gluconate transporter

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --