Regulon of PMI2934 in Proteus mirabilis HI4320

Properties
Regulator type:	Transcription factor
TF locus tag:	PMI2934
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	PMI2934 - Enterobacteriales
Statistics of regulated genes:
- Genes	8
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -56 Score: 6.7 Sequence: TTGCTAACTCGAAGTAGCAA Locus tag: PMI2941 Name: PMI2941 Funciton: Predicted carbohydrate kinase Locus tag: PMI2940 Name: PMI2940 Funciton: Hypothetical protein Locus tag: PMI2939 Name: PMI2939 Funciton: Hypothetical protein Locus tag: PMI2938 Name: PMI2938 Funciton: Hypothetical protein Locus tag: PMI2937 Name: PMI2937 Funciton: Hypothetical protein Locus tag: PMI2936 Name: PMI2936 Funciton: Putative reductase Locus tag: PMI2935 Name: PMI2935 Funciton: Hypothetical protein Locus tag: PMI2934 Name: null Funciton: LacI-family transcriptional regulator
	PMI2941	PMI2941	Predicted carbohydrate kinase
	PMI2940	PMI2940	Hypothetical protein
	PMI2939	PMI2939	Hypothetical protein
	PMI2938	PMI2938	Hypothetical protein
	PMI2937	PMI2937	Hypothetical protein
	PMI2936	PMI2936	Putative reductase
	PMI2935	PMI2935	Hypothetical protein
	PMI2934		LacI-family transcriptional regulator

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD