Profile of regulator PMI2934 in Enterobacteriales
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Regulog: | PMI2934 - Enterobacteriales |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - LacI
- By pathway - Sugar utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Proteus mirabilis HI4320 | |||||
| PMI2941 | PMI2941 | -56 | 6.7 | TTGCTAACTCGAAGTAGCAA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |