Regulog PMI2934 - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Citrobacter koseri ATCC BAA-895 | ||
| Edwardsiella tarda EIB202 | ||
| Enterobacter sp. 638 | ||
| Erwinia amylovora ATCC 49946 | ||
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||
| Escherichia coli str. K-12 substr. MG1655 | ||
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||
| Photorhabdus luminescens subsp. laumondii TTO1 | ||
| Proteus mirabilis HI4320 | 8 | 1 |
| Salmonella typhimurium LT2 | ||
| Serratia proteamaculans 568 | ||
| Yersinia pestis KIM |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| PMI2941 |
Gene: CKO_00688: Predicted carbohydrate kinase |
Gene: ETAE_3361: Predicted carbohydrate kinase |
|
|
|
|
Gene: KPN_02547: Predicted carbohydrate kinase |
Gene: plu3741: Predicted carbohydrate kinase |
*
Proteus mirabilis HI4320 Site: position = -56 score = 6.66837 sequence = TTGCTAACTCGAAGTAGCAA Gene: PMI2941: Predicted carbohydrate kinase |
|
Gene: Spro_4697: Predicted carbohydrate kinase |
Gene: y0231: Predicted carbohydrate kinase |
Predicted carbohydrate kinase |
| PMI2940 |
|
|
|
|
|
|
|
|
Gene: PMI2940: Hypothetical protein |
|
|
|
Hypothetical protein |
| PMI2939 |
|
|
|
|
|
|
|
|
Gene: PMI2939: Hypothetical protein |
|
|
|
Hypothetical protein |
| PMI2938 |
|
|
|
|
|
|
|
|
Gene: PMI2938: Hypothetical protein |
Gene: STM1252: Hypothetical protein |
|
|
Hypothetical protein |
| PMI2937 |
|
|
|
|
|
|
|
|
Gene: PMI2937: Hypothetical protein |
|
|
|
Hypothetical protein |
| PMI2936 |
|
|
|
|
|
|
|
|
Gene: PMI2936: Putative reductase |
|
|
|
Putative reductase |
| PMI2935 |
|
|
|
|
|
|
|
|
Gene: PMI2935: Hypothetical protein |
|
|
|
Hypothetical protein |
| PMI2934 |
|
|
|
|
|
|
|
|
Gene: PMI2934: LacI-family transcriptional regulator |
|
|
|
LacI-family transcriptional regulator |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |