Regulon of BC5402 in Bacillus cereus ATCC 14579

Properties
Regulator type:	Transcription factor
TF locus tag:	BC5402
Regulator family:	LacI
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	BC5402 - Bacillales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - LacI

Regulated operons
	Locus Tag	Name	Function
Position: -63 Score: 6.5 Sequence: ACCTGGTAAGCTTTCCACAA Locus tag: BC5403 Name: BC5403 Funciton: Predicted integral membrane protein
	BC5403	BC5403	Predicted integral membrane protein
Position: -54 Score: 6.5 Sequence: TTGTGGAAAGCTTACCAGGT Locus tag: BC5402 Name: BC5402 Funciton: Predicted transcriptional regulator, LacI family
	BC5402	BC5402	Predicted transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD