Regulog BC5402 - Bacillales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - LacI
| Genome | Genes | Operons |
|---|---|---|
| Anoxybacillus flavithermus WK1 | ||
| Bacillus amyloliquefaciens FZB42 | ||
| Bacillus cereus ATCC 14579 | 2 | 2 |
| Bacillus clausii KSM-K16 | ||
| Bacillus halodurans C-125 | ||
| Bacillus licheniformis DSM 13 | ||
| Bacillus pumilus SAFR-032 | ||
| Bacillus subtilis subsp. subtilis str. 168 | ||
| Geobacillus kaustophilus HTA426 | ||
| Oceanobacillus iheyensis HTE831 | ||
| Paenibacillus sp. JDR-2 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| BC5402 |
|
|
*
Bacillus cereus ATCC 14579 Site: position = -54 score = 6.47901 sequence = TTGTGGAAAGCTTACCAGGT Gene: BC5402: Predicted transcriptional regulator, LacI family |
|
|
|
|
|
|
|
|
Predicted transcriptional regulator, LacI family |
| CRON 2. | ||||||||||||
| BC5403 |
|
|
*
Bacillus cereus ATCC 14579 Site: position = -63 score = 6.47901 sequence = ACCTGGTAAGCTTTCCACAA Gene: BC5403: Predicted integral membrane protein |
|
|
|
|
|
|
|
|
Predicted integral membrane protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |