Profile of regulator BC5402 in Bacillales
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | |
| Effector: | |
| Regulog: | BC5402 - Bacillales |
Member of regulog collections
- By taxonomy - Bacillales
- By TF family - LacI
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Bacillus cereus ATCC 14579 | |||||
| BC5402 | BC5402 | -54 | 6.5 | TTGTGGAAAGCTTACCAGGT | |
| BC5403 | BC5403 | -63 | 6.5 | ACCTGGTAAGCTTTCCACAA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |