Regulon of Jk1423 in Corynebacterium urealyticum DSM 7109

Properties
Regulator type:	Transcription factor
TF locus tag:	cur_0148
Regulator family:	TetR
Regulation mode:	repressor (activator)
Biological process:
Effector:
Regulog:	Jk1423 - Corynebacteriaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By TF family - TetR

Regulated operons
	Locus Tag	Name	Function
Position: -126 Score: 5.6 Sequence: TTGGCAACGCCTTGTTTTCAT Position: -104 Score: 6.4 Sequence: TTGGCAACACGGTGTTGCTAA Locus tag: cur_0150 Name: jk1421 Funciton: Predicted ABC transporter, permease protein Locus tag: cur_0149 Name: jk1422 Funciton: Predicted ABC transporter, ATP-binding protein Locus tag: cur_0148 Name: jk1423 Funciton: Predicted transcriptional regulator, TetR family
	cur_0150	jk1421	Predicted ABC transporter, permease protein
	cur_0149	jk1422	Predicted ABC transporter, ATP-binding protein
	cur_0148	jk1423	Predicted transcriptional regulator, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD