Regulog Jk1423 - Corynebacteriaceae

Properties
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor (activator)
Biological process:
Effector:
Phylum:	Actinobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By TF family - TetR

Statistics of regulated genes
Genome	Genes	Operons
Corynebacterium amycolatum SK46
Corynebacterium aurimucosum ATCC 700975	3	1
Corynebacterium diphtheriae NCTC 13129
Corynebacterium efficiens YS-314
Corynebacterium glutamicum ATCC 13032
Corynebacterium jeikeium K411	3	1
Corynebacterium kroppenstedtii DSM 44385
Corynebacterium urealyticum DSM 7109	3	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes									Function

CRON 1.
jk1421	Corynebacterium amycolatum SK46	* Corynebacterium aurimucosum ATCC 700975 Site: position = -100 score = 6.17126 sequence = TTAGAAACATAGTGTTGCCAT Site: position = -78 score = 6.00158 sequence = ATAGAAACAGAATGTTTCTAT Gene: cauri_1677: Predicted ABC transporter, permease protein	Corynebacterium diphtheriae NCTC 13129	Corynebacterium efficiens YS-314	Corynebacterium glutamicum ATCC 13032	* Corynebacterium jeikeium K411 Site: position = -82 score = 5.97138 sequence = TTGGCAACACATCGTTGCTAA Site: position = -104 score = 5.97138 sequence = TTAGAAACACCCTGTTTTTAT Gene: jk1421: Predicted ABC transporter, permease protein	Corynebacterium kroppenstedtii DSM 44385	* Corynebacterium urealyticum DSM 7109 Site: position = -104 score = 6.39613 sequence = TTGGCAACACGGTGTTGCTAA Site: position = -126 score = 5.60593 sequence = TTGGCAACGCCTTGTTTTCAT Gene: cur_0150: Predicted ABC transporter, permease protein	Predicted ABC transporter, permease protein
jk1422	Corynebacterium amycolatum SK46	Corynebacterium aurimucosum ATCC 700975 Gene: cauri_1678: Predicted ABC transporter, ATP-binding protein	Corynebacterium diphtheriae NCTC 13129	Corynebacterium efficiens YS-314 Gene: CE0490: Predicted ABC transporter, ATP-binding protein	Corynebacterium glutamicum ATCC 13032	Corynebacterium jeikeium K411 Gene: jk1422: Predicted ABC transporter, ATP-binding protein	Corynebacterium kroppenstedtii DSM 44385	Corynebacterium urealyticum DSM 7109 Gene: cur_0149: Predicted ABC transporter, ATP-binding protein	Predicted ABC transporter, ATP-binding protein
jk1423	Corynebacterium amycolatum SK46	Corynebacterium aurimucosum ATCC 700975 Gene: cauri_1679: Predicted transcriptional regulator, TetR family	Corynebacterium diphtheriae NCTC 13129	Corynebacterium efficiens YS-314 Gene: CE0491: Predicted transcriptional regulator, TetR family	Corynebacterium glutamicum ATCC 13032	Corynebacterium jeikeium K411 Gene: jk1423: Predicted transcriptional regulator, TetR family	Corynebacterium kroppenstedtii DSM 44385	Corynebacterium urealyticum DSM 7109 Gene: cur_0148: Predicted transcriptional regulator, TetR family	Predicted transcriptional regulator, TetR family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog Jk1423 - Corynebacteriaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --