Regulog Jk1423 - Corynebacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor (activator) |
| Biological process: | |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Corynebacteriaceae
- By TF family - TetR
| Genome | Genes | Operons |
|---|---|---|
| Corynebacterium amycolatum SK46 | ||
| Corynebacterium aurimucosum ATCC 700975 | 3 | 1 |
| Corynebacterium diphtheriae NCTC 13129 | ||
| Corynebacterium efficiens YS-314 | ||
| Corynebacterium glutamicum ATCC 13032 | ||
| Corynebacterium jeikeium K411 | 3 | 1 |
| Corynebacterium kroppenstedtii DSM 44385 | ||
| Corynebacterium urealyticum DSM 7109 | 3 | 1 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| jk1421 |
|
*
Corynebacterium aurimucosum ATCC 700975 Site: position = -100 score = 6.17126 sequence = TTAGAAACATAGTGTTGCCAT Site: position = -78 score = 6.00158 sequence = ATAGAAACAGAATGTTTCTAT Gene: cauri_1677: Predicted ABC transporter, permease protein |
|
|
|
*
Corynebacterium jeikeium K411 Site: position = -82 score = 5.97138 sequence = TTGGCAACACATCGTTGCTAA Site: position = -104 score = 5.97138 sequence = TTAGAAACACCCTGTTTTTAT Gene: jk1421: Predicted ABC transporter, permease protein |
|
*
Corynebacterium urealyticum DSM 7109 Site: position = -104 score = 6.39613 sequence = TTGGCAACACGGTGTTGCTAA Site: position = -126 score = 5.60593 sequence = TTGGCAACGCCTTGTTTTCAT Gene: cur_0150: Predicted ABC transporter, permease protein |
Predicted ABC transporter, permease protein |
| jk1422 |
|
Gene: cauri_1678: Predicted ABC transporter, ATP-binding protein |
|
Gene: CE0490: Predicted ABC transporter, ATP-binding protein |
|
Gene: jk1422: Predicted ABC transporter, ATP-binding protein |
|
Gene: cur_0149: Predicted ABC transporter, ATP-binding protein |
Predicted ABC transporter, ATP-binding protein |
| jk1423 |
|
Gene: cauri_1679: Predicted transcriptional regulator, TetR family |
|
Gene: CE0491: Predicted transcriptional regulator, TetR family |
|
Gene: jk1423: Predicted transcriptional regulator, TetR family |
|
Gene: cur_0148: Predicted transcriptional regulator, TetR family |
Predicted transcriptional regulator, TetR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |