Regulon of Cg2314 in Corynebacterium glutamicum ATCC 13032

Properties
Regulator type:	Transcription factor
TF locus tag:	cg2314
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Cg2314 - Corynebacteriaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -51 Score: 6.4 Sequence: CTACTAGAACGTTATAGTAG Locus tag: cg2313 Name: cg2313 Funciton: Predicted sugar dehydrogenase Locus tag: cg2312 Name: cg2312 Funciton: Predicted sugar isomerase
	cg2313	cg2313	Predicted sugar dehydrogenase
	cg2312	cg2312	Predicted sugar isomerase
Position: -95 Score: 6.4 Sequence: CTACTATAACGTTCTAGTAG Locus tag: cg2314 Name: cg2314 Funciton: Predicted transcription regulator, LacI family
	cg2314	cg2314	Predicted transcription regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD