Profile of regulator Cg2314 in Corynebacteriaceae
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Regulog: | Cg2314 - Corynebacteriaceae |
Member of regulog collections
- By taxonomy - Corynebacteriaceae
- By TF family - LacI
- By pathway - Sugar utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Corynebacterium glutamicum ATCC 13032 | |||||
| cg2314 | cg2314 | -95 | 6.4 | CTACTATAACGTTCTAGTAG | |
| cg2313 | cg2313 | -51 | 6.4 | CTACTAGAACGTTATAGTAG | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |