Regulon of BglR3 in Caulobacter sp. K31

Properties
Regulator type:	Transcription factor
TF locus tag:	Caul_3555
Regulator family:	LacI
Regulation mode:
Biological process:	Beta-glucosides utilization
Effector:	Beta-glucoside; Glucose
Regulog:	BglR3 - Caulobacterales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Caulobacterales
By TF family - LacI
By effector - Beta-glucoside
By effector - Glucose
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -249 Score: 5.6 Sequence: GCGCCGCCACGTCATAGATC Locus tag: Caul_3554 Name: bglT Funciton: Putative beta-glucoside permease, MFS superfamily
	Caul_3554	bglT	Putative beta-glucoside permease, MFS superfamily
Position: 14 Score: 5.6 Sequence: GATCTATGACGTGGCGGCGC Locus tag: Caul_3555 Name: bglR3 Funciton: Transcriptional regulator of beta-glucoside utilization, LacI family
	Caul_3555	bglR3	Transcriptional regulator of beta-glucoside utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD