Regulog BglR3 - Caulobacterales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Beta-glucosides utilization |
| Effector: | Beta-glucoside; Glucose |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Caulobacterales
- By TF family - LacI
- By effector - Beta-glucoside
- By effector - Glucose
- By pathway - Beta-glucosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Caulobacter crescentus CB15 | 2 | 2 |
| Caulobacter segnis ATCC 21756 | 2 | 2 |
| Caulobacter sp. K31 | 2 | 2 |
| Phenylobacterium zucineum HLK1 | 2 | 2 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| bglR3 |
*
Caulobacter crescentus CB15 Site: position = 14 score = 5.76889 sequence = GATCTACGACGTCGCCGCGA Gene: CC2316: Transcriptional regulator of beta-glucoside utilization, LacI family |
*
Caulobacter segnis ATCC 21756 Site: position = 14 score = 6.0806 sequence = GATCTACGACGTCGCCGCGC Gene: Cseg_3095: Transcriptional regulator of beta-glucoside utilization, LacI family |
*
Caulobacter sp. K31 Site: position = 14 score = 5.5849 sequence = GATCTATGACGTGGCGGCGC Gene: Caul_3555: Transcriptional regulator of beta-glucoside utilization, LacI family |
*
Phenylobacterium zucineum HLK1 Site: position = 14 score = 5.98346 sequence = GATCTACGACGTGGCGGAGC Gene: PHZ_c2927: Transcriptional regulator of beta-glucoside utilization, LacI family |
Transcriptional regulator of beta-glucoside utilization, LacI family |
| CRON 2. | |||||
| bglT |
*
Caulobacter crescentus CB15 Site: position = -200 score = 5.76889 sequence = TCGCGGCGACGTCGTAGATC Gene: CC2315: Putative beta-glucoside permease, MFS superfamily |
*
Caulobacter segnis ATCC 21756 Site: position = -252 score = 6.0806 sequence = GCGCGGCGACGTCGTAGATC Gene: Cseg_3094: Putative beta-glucoside permease, MFS superfamily |
*
Caulobacter sp. K31 Site: position = -249 score = 5.5849 sequence = GCGCCGCCACGTCATAGATC Gene: Caul_3554: Putative beta-glucoside permease, MFS superfamily |
*
Phenylobacterium zucineum HLK1 Site: position = -131 score = 5.98346 sequence = GCTCCGCCACGTCGTAGATC Gene: PHZ_c2928: Putative beta-glucoside permease, MFS superfamily |
Putative beta-glucoside permease, MFS superfamily |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |