Regulon of GalR in Shewanella woodyi ATCC 51908

Properties
Regulator type:	Transcription factor
TF locus tag:	Swoo_2083
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactose utilization
Effector:	Galactose
Regulog:	GalR - Shewanellaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - LacI
By effector - Galactose
By pathway - Galactose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -51 Score: 5.8 Sequence: AAATGGAAACGTTTACATTT Locus tag: Swoo_2084 Name: galT2 Funciton: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.10) Locus tag: Swoo_2085 Name: galK2 Funciton: Galactokinase (EC 2.7.1.6) Locus tag: Swoo_2086 Name: galP2 Funciton: Predicted sodium-dependent galactose transporter
	Swoo_2084	galT2	Galactose-1-phosphate uridylyltransferase (EC 2.7.7.10)
	Swoo_2085	galK2	Galactokinase (EC 2.7.1.6)
	Swoo_2086	galP2	Predicted sodium-dependent galactose transporter
Position: -18 Score: 4.9 Sequence: TAATGTAAACGTTATCTTAT Locus tag: Swoo_2083 Name: galR Funciton: galactose utilization repressor, LacI family
	Swoo_2083	galR	galactose utilization repressor, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD