Profile of regulator GalR in Shewanellaceae
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Galactose utilization |
| Effector: | Galactose |
| Regulog: | GalR - Shewanellaceae |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By TF family - LacI
- By effector - Galactose
- By pathway - Galactose utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Shewanella woodyi ATCC 51908 | |||||
| Swoo_2083 | galR | -18 | 4.9 | TAATGTAAACGTTATCTTAT | |
| Swoo_2084 | galT2 | -51 | 5.8 | AAATGGAAACGTTTACATTT | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |