Regulog GalR - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Galactose utilization |
| Effector: | Galactose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By TF family - LacI
- By effector - Galactose
- By pathway - Galactose utilization
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | ||
| Shewanella putrefaciens CN-32 | ||
| Shewanella sp W3-18-1 | ||
| Shewanella sp ANA-3 | ||
| Shewanella sp MR-4 | ||
| Shewanella sp MR-7 | ||
| Shewanella baltica OS155 | ||
| Shewanella denitrificans OS217 | ||
| Shewanella frigidimarina NCIMB 400 | ||
| Shewanella amazonensis SB2B | ||
| Shewanella loihica PV-4 | ||
| Shewanella pealeana ATCC 700345 | ||
| Shewanella halifaxensis HAW-EB4 | ||
| Shewanella piezotolerans WP3 | ||
| Shewanella sediminis HAW-EB3 | ||
| Shewanella woodyi ATCC 51908 | 4 | 2 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| galT2 |
|
|
|
|
|
|
|
|
|
|
Gene: Shew_2288: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.10) |
|
|
|
|
*
Shewanella woodyi ATCC 51908 Site: position = -51 score = 5.83185 sequence = AAATGGAAACGTTTACATTT Gene: Swoo_2084: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.10) |
Galactose-1-phosphate uridylyltransferase (EC 2.7.7.10) |
| galK2 |
|
|
|
|
|
|
|
|
|
|
Gene: Shew_2287: Galactokinase (EC 2.7.1.6) |
|
|
|
|
Gene: Swoo_2085: Galactokinase (EC 2.7.1.6) |
Galactokinase (EC 2.7.1.6) |
| galP2 |
|
|
|
|
|
|
|
|
|
|
Gene: Shew_2286: Predicted sodium-dependent galactose transporter |
|
|
|
|
Gene: Swoo_2086: Predicted sodium-dependent galactose transporter |
Predicted sodium-dependent galactose transporter |
| CRON 2. | |||||||||||||||||
| galR |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
*
Shewanella woodyi ATCC 51908 Site: position = -18 score = 4.89618 sequence = TAATGTAAACGTTATCTTAT Gene: Swoo_2083: galactose utilization repressor, LacI family |
galactose utilization repressor, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |