Regulon of IdnR in Xanthobacter autotrophicus Py2

Properties
Regulator type:	Transcription factor
TF locus tag:	Xaut_2434
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Idonate utilization
Effector:	L-idonate
Regulog:	IdnR - Rhizobiales
Statistics of regulated genes:
- Genes	9
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By effector - L-idonate
By pathway - Idonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -81 Score: 5.7 Sequence: TCATGATATCGGTAACATGA Locus tag: Xaut_2436 Name: idnD Funciton: L-idonate 5-dehydrogenase (EC 1.1.1.264) Locus tag: Xaut_2435 Name: SSF54909 Funciton: Dimeric alpha-beta barrel Locus tag: Xaut_2434 Name: idnR Funciton: Predicted transcriptional regulator of L-idonate utilization, LacI family Locus tag: Xaut_2433 Name: gnd Funciton: 6-phosphogluconate dehydrogenase EC=1.1.1.44
	Xaut_2436	idnD	L-idonate 5-dehydrogenase (EC 1.1.1.264)
	Xaut_2435	SSF54909	Dimeric alpha-beta barrel
	Xaut_2434	idnR	Predicted transcriptional regulator of L-idonate utilization, LacI family
	Xaut_2433	gnd	6-phosphogluconate dehydrogenase EC=1.1.1.44
Position: -83 Score: 5.7 Sequence: TCATGTTACCGATATCATGA Locus tag: Xaut_2437 Name: idnO Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69) Locus tag: Xaut_2438 Name: Atu4687 Funciton: putative ABC transporter, substrate-binding component Locus tag: Xaut_2439 Name: Atu4688 Funciton: putative ABC transporter, membrane spanning protein Locus tag: Xaut_2440 Name: Atu4689 Funciton: putative ABC transporter, membrane spanning protein Locus tag: Xaut_2441 Name: Atu4690 Funciton: putative ABC transporter, ATPase protein
	Xaut_2437	idnO	Gluconate 5-dehydrogenase (EC 1.1.1.69)
	Xaut_2438	Atu4687	putative ABC transporter, substrate-binding component
	Xaut_2439	Atu4688	putative ABC transporter, membrane spanning protein
	Xaut_2440	Atu4689	putative ABC transporter, membrane spanning protein
	Xaut_2441	Atu4690	putative ABC transporter, ATPase protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD