Regulon of IdnR in Rhizobium sp. NGR234

Properties
Regulator type:	Transcription factor
TF locus tag:	NGR_b22310, NGR_b22380
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Idonate utilization
Effector:	L-idonate
Regulog:	IdnR - Rhizobiales
Statistics of regulated genes:
- Genes	15
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By effector - L-idonate
By pathway - Idonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -21 Score: 6.7 Sequence: TTATGTTATCGATAACATTC Locus tag: NGR_b22260 Name: COG1063 Funciton: Threonine dehydrogenase and related Zn-dependent dehydrogenases Locus tag: NGR_b22250 Name: idnD Funciton: L-idonate 5-dehydrogenase (EC 1.1.1.264)
	NGR_b22260	COG1063	Threonine dehydrogenase and related Zn-dependent dehydrogenases
	NGR_b22250	idnD	L-idonate 5-dehydrogenase (EC 1.1.1.264)
Position: -217 Score: 6.5 Sequence: ATTTGTTATCGATAACATCT Locus tag: NGR_b22370 Name: Atu4687 Funciton: putative ABC transporter, substrate-binding component Locus tag: NGR_b22360 Name: Atu4688 Funciton: putative ABC transporter, membrane spanning protein Locus tag: NGR_b22350 Name: Atu4689 Funciton: putative ABC transporter, membrane spanning protein Locus tag: NGR_b22340 Name: Atu4690 Funciton: putative ABC transporter, ATPase protein
	NGR_b22370	Atu4687	putative ABC transporter, substrate-binding component
	NGR_b22360	Atu4688	putative ABC transporter, membrane spanning protein
	NGR_b22350	Atu4689	putative ABC transporter, membrane spanning protein
	NGR_b22340	Atu4690	putative ABC transporter, ATPase protein
Position: -88 Score: 4.8 Sequence: GAAGGTTATCGTTAACTTAG Position: -67 Score: 6.5 Sequence: AGATGTTATCGATAACAAAT Locus tag: NGR_b22380 Name: idnR Funciton: Predicted transcriptional regulator of L-idonate utilization, LacI family
	NGR_b22380	idnR	Predicted transcriptional regulator of L-idonate utilization, LacI family
Position: -54 Score: 6.5 Sequence: TCATGTTATCGATAACATAA Locus tag: NGR_b22410 Name: null Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: NGR_b22400 Name: null Funciton: Sugar ABC transporter, inner membrane protein Locus tag: NGR_b22390 Name: null Funciton: Sugar ABC transporter, substrate-binding protein
	NGR_b22410		Sugar ABC transporter, ATP-binding protein
	NGR_b22400		Sugar ABC transporter, inner membrane protein
	NGR_b22390		Sugar ABC transporter, substrate-binding protein
Position: -48 Score: 6.7 Sequence: GAATGTTATCGATAACATAA Locus tag: NGR_b22270 Name: idnO Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69) Locus tag: NGR_b22280 Name: idnK Funciton: Gluconokinase (EC 2.7.1.12) Locus tag: NGR_b22290 Name: gnd Funciton: 6-phosphogluconate dehydrogenase EC=1.1.1.44 Locus tag: NGR_b22300 Name: SSF54909 Funciton: Dimeric alpha-beta barrel Locus tag: NGR_b22310 Name: idnR Funciton: Predicted transcriptional regulator of L-idonate utilization, LacI family
	NGR_b22270	idnO	Gluconate 5-dehydrogenase (EC 1.1.1.69)
	NGR_b22280	idnK	Gluconokinase (EC 2.7.1.12)
	NGR_b22290	gnd	6-phosphogluconate dehydrogenase EC=1.1.1.44
	NGR_b22300	SSF54909	Dimeric alpha-beta barrel
	NGR_b22310	idnR	Predicted transcriptional regulator of L-idonate utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of IdnR in Rhizobium sp. NGR234

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --