Regulon of IdnR in Rhizobium etli CFN 42

Properties
Regulator type:	Transcription factor
TF locus tag:	RHE_PC00141
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Idonate utilization
Effector:	L-idonate
Regulog:	IdnR - Rhizobiales
Statistics of regulated genes:
- Genes	10
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By effector - L-idonate
By pathway - Idonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -132 Score: 4.9 Sequence: TAAAGTTATCGCTATCATCG Position: -37 Score: 6.1 Sequence: GGATGATATCGATAACAAAT Locus tag: RHE_PC00140 Name: gnl Funciton: Gluconolactonase (EC 3.1.1.17)
	RHE_PC00140	gnl	Gluconolactonase (EC 3.1.1.17)
Position: -98 Score: 6.8 Sequence: ATATGTTATCGATAACATAA Locus tag: RHE_PC00143 Name: COG1063 Funciton: Threonine dehydrogenase and related Zn-dependent dehydrogenases Locus tag: RHE_PC00142 Name: idnD Funciton: L-idonate 5-dehydrogenase (EC 1.1.1.264)
	RHE_PC00143	COG1063	Threonine dehydrogenase and related Zn-dependent dehydrogenases
	RHE_PC00142	idnD	L-idonate 5-dehydrogenase (EC 1.1.1.264)
Position: -57 Score: 6.8 Sequence: GAATGTTATCGATAACATAT Locus tag: RHE_PC00147 Name: null Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: RHE_PC00148 Name: null Funciton: Sugar ABC transporter, inner membrane protein Locus tag: RHE_PC00149 Name: null Funciton: Sugar ABC transporter, substrate-binding protein
	RHE_PC00147		Sugar ABC transporter, ATP-binding protein
	RHE_PC00148		Sugar ABC transporter, inner membrane protein
	RHE_PC00149		Sugar ABC transporter, substrate-binding protein
Position: -105 Score: 6.8 Sequence: TTATGTTATCGATAACATAT Locus tag: RHE_PC00144 Name: idnO Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69) Locus tag: RHE_PC00145 Name: idnK Funciton: Gluconokinase (EC 2.7.1.12) Locus tag: RHE_PC00146 Name: gnd Funciton: 6-phosphogluconate dehydrogenase EC=1.1.1.44
	RHE_PC00144	idnO	Gluconate 5-dehydrogenase (EC 1.1.1.69)
	RHE_PC00145	idnK	Gluconokinase (EC 2.7.1.12)
	RHE_PC00146	gnd	6-phosphogluconate dehydrogenase EC=1.1.1.44
Position: -226 Score: 6.1 Sequence: ATTTGTTATCGATATCATCC Position: -131 Score: 4.9 Sequence: CGATGATAGCGATAACTTTA Locus tag: RHE_PC00141 Name: idnR Funciton: Predicted transcriptional regulator of L-idonate utilization, LacI family
	RHE_PC00141	idnR	Predicted transcriptional regulator of L-idonate utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD