Regulon of IdnR in Bradyrhizobium sp. BTAi1

Properties
Regulator type:	Transcription factor
TF locus tag:	BBta_0778
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Idonate utilization
Effector:	L-idonate
Regulog:	IdnR - Rhizobiales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By effector - L-idonate
By pathway - Idonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -114 Score: 5.7 Sequence: GATTGTTATCGATATCACTG Locus tag: BBta_0778 Name: idnR Funciton: Predicted transcriptional regulator of L-idonate utilization, LacI family
	BBta_0778	idnR	Predicted transcriptional regulator of L-idonate utilization, LacI family
Position: -58 Score: 6 Sequence: TCCTGTTATCGATAACATAG Locus tag: BBta_0777 Name: idnO Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69)
	BBta_0777	idnO	Gluconate 5-dehydrogenase (EC 1.1.1.69)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD