Regulon of IdnR in Azorhizobium caulinodans ORS 571

Properties
Regulator type:	Transcription factor
TF locus tag:	AZC_2611
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Idonate utilization
Effector:	L-idonate
Regulog:	IdnR - Rhizobiales
Statistics of regulated genes:
- Genes	10
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By effector - L-idonate
By pathway - Idonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -96 Score: 6 Sequence: TTTTGTTACCGATAACATGC Locus tag: AZC_2614 Name: idnO Funciton: Gluconate 5-dehydrogenase (EC 1.1.1.69) Locus tag: AZC_2615 Name: Atu4687 Funciton: putative ABC transporter, substrate-binding component Locus tag: AZC_2616 Name: Atu4688 Funciton: putative ABC transporter, membrane spanning protein Locus tag: AZC_2617 Name: Atu4689 Funciton: putative ABC transporter, membrane spanning protein Locus tag: AZC_2618 Name: Atu4690 Funciton: putative ABC transporter, ATPase protein Locus tag: AZC_2619 Name: COG1063 Funciton: Threonine dehydrogenase and related Zn-dependent dehydrogenases
	AZC_2614	idnO	Gluconate 5-dehydrogenase (EC 1.1.1.69)
	AZC_2615	Atu4687	putative ABC transporter, substrate-binding component
	AZC_2616	Atu4688	putative ABC transporter, membrane spanning protein
	AZC_2617	Atu4689	putative ABC transporter, membrane spanning protein
	AZC_2618	Atu4690	putative ABC transporter, ATPase protein
	AZC_2619	COG1063	Threonine dehydrogenase and related Zn-dependent dehydrogenases
Position: -62 Score: 6 Sequence: GCATGTTATCGGTAACAAAA Locus tag: AZC_2613 Name: idnD Funciton: L-idonate 5-dehydrogenase (EC 1.1.1.264) Locus tag: AZC_2612 Name: SSF54909 Funciton: Dimeric alpha-beta barrel Locus tag: AZC_2611 Name: idnR Funciton: Predicted transcriptional regulator of L-idonate utilization, LacI family Locus tag: AZC_2610 Name: gnd Funciton: 6-phosphogluconate dehydrogenase EC=1.1.1.44
	AZC_2613	idnD	L-idonate 5-dehydrogenase (EC 1.1.1.264)
	AZC_2612	SSF54909	Dimeric alpha-beta barrel
	AZC_2611	idnR	Predicted transcriptional regulator of L-idonate utilization, LacI family
	AZC_2610	gnd	6-phosphogluconate dehydrogenase EC=1.1.1.44

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD