Regulon of AZL_a08610 in Azospirillum sp. B510

Properties
Regulator type:	Transcription factor
TF locus tag:	AZL_a08610
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	AZL_a08610 - Rhodospirillales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -114 Score: 6.3 Sequence: CGATGTAAGCGCTTACATAG Position: -47 Score: 5 Sequence: ATATGTAACCGCTTTCAAAA Locus tag: AZL_a08610 Name: AZL_a08610 Funciton: Transcriptional regulator, LacI family
	AZL_a08610	AZL_a08610	Transcriptional regulator, LacI family
Position: -174 Score: 5 Sequence: TTTTGAAAGCGGTTACATAT Position: -107 Score: 6.3 Sequence: CTATGTAAGCGCTTACATCG Locus tag: AZL_a08600 Name: dctP Funciton: C4-dicarboxylate ABC transporter, periplasmic component Locus tag: AZL_a08590 Name: dapA Funciton: dihydrodipicolinate synthase Locus tag: AZL_a08580 Name: dctQ Funciton: C4-dicarboxylate ABC transporter, small permease component Locus tag: AZL_a08570 Name: dctM Funciton: C4-dicarboxylate ABC transporter, large permease component
	AZL_a08600	dctP	C4-dicarboxylate ABC transporter, periplasmic component
	AZL_a08590	dapA	dihydrodipicolinate synthase
	AZL_a08580	dctQ	C4-dicarboxylate ABC transporter, small permease component
	AZL_a08570	dctM	C4-dicarboxylate ABC transporter, large permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD