Regulog AZL_a08610 - Rhodospirillales

Member of regulog collections
- By taxonomy - Rhodospirillales
- By TF family - LacI
- By pathway - Sugar utilization
Genome | Genes | Operons |
---|---|---|
Gluconacetobacter diazotrophicus PAl 5 | ||
Gluconobacter oxydans 621H | ||
Granulibacter bethesdensis CGDNIH1 | ||
Magnetospirillum magneticum AMB-1 | ||
Magnetospirillum magnetotacticum MS-1 | ||
Azospirillum sp. B510 | 5 | 2 |
Acetobacter pasteurianus IFO 3283-01 | ||
Rhodospirillum centenum SW | ||
Rhodospirillum rubrum ATCC 11170 |
Genes | Function | |||||||||
---|---|---|---|---|---|---|---|---|---|---|
CRON 1. | ||||||||||
dctP |
|
|
|
|
|
*
Azospirillum sp. B510 Site: position = -174 score = 5.03036 sequence = TTTTGAAAGCGGTTACATAT Site: position = -107 score = 6.33379 sequence = CTATGTAAGCGCTTACATCG Gene: AZL_a08600: C4-dicarboxylate ABC transporter, periplasmic component |
|
|
|
C4-dicarboxylate ABC transporter, periplasmic component |
dapA |
|
|
|
|
|
Gene: AZL_a08590: dihydrodipicolinate synthase |
|
|
|
dihydrodipicolinate synthase |
dctQ |
|
|
|
|
|
Gene: AZL_a08580: C4-dicarboxylate ABC transporter, small permease component |
|
|
|
C4-dicarboxylate ABC transporter, small permease component |
dctM |
|
|
|
|
|
Gene: AZL_a08570: C4-dicarboxylate ABC transporter, large permease component |
|
|
|
C4-dicarboxylate ABC transporter, large permease component |
CRON 2. | ||||||||||
AZL_a08610 |
|
|
|
|
|
*
Azospirillum sp. B510 Site: position = -114 score = 6.33379 sequence = CGATGTAAGCGCTTACATAG Site: position = -47 score = 5.03036 sequence = ATATGTAACCGCTTTCAAAA Gene: AZL_a08610: Transcriptional regulator, LacI family |
|
|
|
Transcriptional regulator, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |