Regulog AZL_a08610 - Rhodospirillales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/Alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By TF family - LacI
By pathway - Sugar utilization

Statistics of regulated genes
Genome	Genes	Operons
Gluconacetobacter diazotrophicus PAl 5
Gluconobacter oxydans 621H
Granulibacter bethesdensis CGDNIH1
Magnetospirillum magneticum AMB-1
Magnetospirillum magnetotacticum MS-1
Azospirillum sp. B510	5	2
Acetobacter pasteurianus IFO 3283-01
Rhodospirillum centenum SW
Rhodospirillum rubrum ATCC 11170

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes										Function

CRON 1.
dctP	Gluconacetobacter diazotrophicus PAl 5	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	Magnetospirillum magneticum AMB-1	Magnetospirillum magnetotacticum MS-1	* Azospirillum sp. B510 Site: position = -174 score = 5.03036 sequence = TTTTGAAAGCGGTTACATAT Site: position = -107 score = 6.33379 sequence = CTATGTAAGCGCTTACATCG Gene: AZL_a08600: C4-dicarboxylate ABC transporter, periplasmic component	Acetobacter pasteurianus IFO 3283-01	Rhodospirillum centenum SW	Rhodospirillum rubrum ATCC 11170	C4-dicarboxylate ABC transporter, periplasmic component
dapA	Gluconacetobacter diazotrophicus PAl 5	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	Magnetospirillum magneticum AMB-1	Magnetospirillum magnetotacticum MS-1	Azospirillum sp. B510 Gene: AZL_a08590: dihydrodipicolinate synthase	Acetobacter pasteurianus IFO 3283-01	Rhodospirillum centenum SW	Rhodospirillum rubrum ATCC 11170	dihydrodipicolinate synthase
dctQ	Gluconacetobacter diazotrophicus PAl 5	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	Magnetospirillum magneticum AMB-1	Magnetospirillum magnetotacticum MS-1	Azospirillum sp. B510 Gene: AZL_a08580: C4-dicarboxylate ABC transporter, small permease component	Acetobacter pasteurianus IFO 3283-01	Rhodospirillum centenum SW	Rhodospirillum rubrum ATCC 11170	C4-dicarboxylate ABC transporter, small permease component
dctM	Gluconacetobacter diazotrophicus PAl 5	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	Magnetospirillum magneticum AMB-1	Magnetospirillum magnetotacticum MS-1	Azospirillum sp. B510 Gene: AZL_a08570: C4-dicarboxylate ABC transporter, large permease component	Acetobacter pasteurianus IFO 3283-01	Rhodospirillum centenum SW	Rhodospirillum rubrum ATCC 11170	C4-dicarboxylate ABC transporter, large permease component

CRON 2.
AZL_a08610	Gluconacetobacter diazotrophicus PAl 5	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	Magnetospirillum magneticum AMB-1	Magnetospirillum magnetotacticum MS-1	* Azospirillum sp. B510 Site: position = -114 score = 6.33379 sequence = CGATGTAAGCGCTTACATAG Site: position = -47 score = 5.03036 sequence = ATATGTAACCGCTTTCAAAA Gene: AZL_a08610: Transcriptional regulator, LacI family	Acetobacter pasteurianus IFO 3283-01	Rhodospirillum centenum SW	Rhodospirillum rubrum ATCC 11170	Transcriptional regulator, LacI family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog AZL_a08610 - Rhodospirillales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --