Regulon of y3436 in Yersinia pestis KIM

Properties
Regulator type:	Transcription factor
TF locus tag:	y3436
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	y3436 - Enterobacteriales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -257 Score: 6.6 Sequence: AATATATTAGCTAATAAACT Locus tag: y3436 Name: y3436 Funciton: Transcriptional regulator, LacI family
	y3436	y3436	Transcriptional regulator, LacI family
Position: -192 Score: 6.6 Sequence: AGTTTATTAGCTAATATATT Locus tag: y3438 Name: GH5 Funciton: Glycoside hydrolase, family 5
	y3438	GH5	Glycoside hydrolase, family 5

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD