Regulog y3436 - Enterobacteriales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Citrobacter koseri ATCC BAA-895
Edwardsiella tarda EIB202
Enterobacter sp. 638
Erwinia amylovora ATCC 49946
Erwinia carotovora subsp. atroseptica SCRI1043
Escherichia coli str. K-12 substr. MG1655
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Photorhabdus luminescens subsp. laumondii TTO1
Proteus mirabilis HI4320
Salmonella typhimurium LT2
Serratia proteamaculans 568
Yersinia pestis KIM	2	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes													Function

CRON 1.
y3436	Citrobacter koseri ATCC BAA-895	Edwardsiella tarda EIB202	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Erwinia carotovora subsp. atroseptica SCRI1043	Escherichia coli str. K-12 substr. MG1655	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Photorhabdus luminescens subsp. laumondii TTO1	Proteus mirabilis HI4320	Salmonella typhimurium LT2	Serratia proteamaculans 568	* Yersinia pestis KIM Site: position = -257 score = 6.63332 sequence = AATATATTAGCTAATAAACT Gene: y3436: Transcriptional regulator, LacI family	Transcriptional regulator, LacI family

CRON 2.
GH5	Citrobacter koseri ATCC BAA-895	Edwardsiella tarda EIB202	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Erwinia carotovora subsp. atroseptica SCRI1043	Escherichia coli str. K-12 substr. MG1655	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Photorhabdus luminescens subsp. laumondii TTO1	Proteus mirabilis HI4320	Salmonella typhimurium LT2	Serratia proteamaculans 568	* Yersinia pestis KIM Site: position = -192 score = 6.63332 sequence = AGTTTATTAGCTAATATATT Gene: y3438: Glycoside hydrolase, family 5	Glycoside hydrolase, family 5

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --