Profile of regulator y3436 in Enterobacteriales
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Regulog: | y3436 - Enterobacteriales |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - LacI
- By pathway - Sugar utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Yersinia pestis KIM | |||||
| y3438 | GH5 | -192 | 6.6 | AGTTTATTAGCTAATATATT | |
| y3436 | y3436 | -257 | 6.6 | AATATATTAGCTAATAAACT | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |