Regulon of YtrA2 in Macrococcus caseolyticus JCSC5402

Properties
Regulator type:	Transcription factor
TF locus tag:	MCCL_0413
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux; Antibiotic resistance
Effector:
Regulog:	YtrA2 - Staphylococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By TF family - GntR/Others
By pathway - Multidrug resistance
By pathway - Multidrug efflux
By pathway - Antibiotic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -51 Score: 6.4 Sequence: GTGTGTATTATATTATATAGTACAGTT Locus tag: MCCL_0413 Name: ytrA2 Funciton: Transcription regulator, GntR family Locus tag: MCCL_0414 Name: ytrB Funciton: ABC-type multidrug transporter, ATPase component Locus tag: MCCL_0415 Name: ytrC/ytrD Funciton: ABC-type multidrug transporter, permease component
	MCCL_0413	ytrA2	Transcription regulator, GntR family
	MCCL_0414	ytrB	ABC-type multidrug transporter, ATPase component
	MCCL_0415	ytrC/ytrD	ABC-type multidrug transporter, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD