Profile of regulator YtrA2 in Staphylococcaceae
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux; Antibiotic resistance |
| Effector: | |
| Regulog: | YtrA2 - Staphylococcaceae |
Member of regulog collections
- By taxonomy - Staphylococcaceae
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
- By pathway - Antibiotic resistance
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Macrococcus caseolyticus JCSC5402 | |||||
| MCCL_0413 | ytrA2 | -51 | 6.4 | GTGTGTATTATATTATATAGTACAGTT | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |