Regulog YtrA2 - Staphylococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug resistance; Multidrug efflux; Antibiotic resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Staphylococcaceae
- By TF family - GntR/Others
- By pathway - Multidrug resistance
- By pathway - Multidrug efflux
- By pathway - Antibiotic resistance
| Genome | Genes | Operons |
|---|---|---|
| Macrococcus caseolyticus JCSC5402 | 3 | 1 |
| Staphylococcus aureus subsp. aureus N315 | ||
| Staphylococcus capitis SK14 | ||
| Staphylococcus carnosus subsp. carnosus TM300 | ||
| Staphylococcus epidermidis ATCC 12228 | ||
| Staphylococcus haemolyticus JCSC1435 | ||
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| ytrA2 |
*
Macrococcus caseolyticus JCSC5402 Site: position = -51 score = 6.43283 sequence = GTGTGTATTATATTATATAGTACAGTT Gene: MCCL_0413: Transcription regulator, GntR family |
|
|
|
|
|
|
Transcription regulator, GntR family |
| ytrB |
Gene: MCCL_0414: ABC-type multidrug transporter, ATPase component |
|
|
|
|
|
|
ABC-type multidrug transporter, ATPase component |
| ytrC/ytrD |
Gene: MCCL_0415: ABC-type multidrug transporter, permease component |
|
|
|
|
|
|
ABC-type multidrug transporter, permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |