Regulog YtrA2 - Staphylococcaceae

Properties
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux; Antibiotic resistance
Effector:
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Macrococcus caseolyticus JCSC5402	3	1
Staphylococcus aureus subsp. aureus N315
Staphylococcus capitis SK14
Staphylococcus carnosus subsp. carnosus TM300
Staphylococcus epidermidis ATCC 12228
Staphylococcus haemolyticus JCSC1435
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes								Function

CRON 1.
ytrA2	* Macrococcus caseolyticus JCSC5402 Site: position = -51 score = 6.43283 sequence = GTGTGTATTATATTATATAGTACAGTT Gene: MCCL_0413: Transcription regulator, GntR family	Staphylococcus aureus subsp. aureus N315	Staphylococcus capitis SK14	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus epidermidis ATCC 12228	Staphylococcus haemolyticus JCSC1435	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	Transcription regulator, GntR family
ytrB	Macrococcus caseolyticus JCSC5402 Gene: MCCL_0414: ABC-type multidrug transporter, ATPase component	Staphylococcus aureus subsp. aureus N315	Staphylococcus capitis SK14	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus epidermidis ATCC 12228	Staphylococcus haemolyticus JCSC1435	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	ABC-type multidrug transporter, ATPase component
ytrC/ytrD	Macrococcus caseolyticus JCSC5402 Gene: MCCL_0415: ABC-type multidrug transporter, permease component	Staphylococcus aureus subsp. aureus N315	Staphylococcus capitis SK14	Staphylococcus carnosus subsp. carnosus TM300	Staphylococcus epidermidis ATCC 12228	Staphylococcus haemolyticus JCSC1435	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	ABC-type multidrug transporter, permease component

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --