Regulon of RhmR in Chloroflexus sp. Y-400-fl

Properties
Regulator type:	Transcription factor
TF locus tag:	Chy400_0392
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Rhamnose oligosaccharides utilization
Effector:
Regulog:	RhmR - Chloroflexia
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - LacI
By pathway - Rhamnose oligosaccharides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -177 Score: 5.7 Sequence: CATACCGATCGATGCCCAGG Locus tag: Chy400_0391 Name: rhmE Funciton: Predicted rhamnose oligosaccharide ABC transporter, extracellular solute-binding component Locus tag: Chy400_0390 Name: rhmF Funciton: Predicted rhamnose oligosaccharide ABC transporter, inner membrane component Locus tag: Chy400_0389 Name: rhmG Funciton: Predicted rhamnose oligosaccharide ABC transporter, inner membrane component Locus tag: Chy400_0388 Name: rhmA Funciton: alpha-L-rhamnosidase Locus tag: Chy400_0387 Name: GH1 Funciton: glycoside hydrolase family 1
	Chy400_0391	rhmE	Predicted rhamnose oligosaccharide ABC transporter, extracellular solute-binding component
	Chy400_0390	rhmF	Predicted rhamnose oligosaccharide ABC transporter, inner membrane component
	Chy400_0389	rhmG	Predicted rhamnose oligosaccharide ABC transporter, inner membrane component
	Chy400_0388	rhmA	alpha-L-rhamnosidase
	Chy400_0387	GH1	glycoside hydrolase family 1

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD