Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Profile of regulator RhmR in Chloroflexia

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Rhamnose oligosaccharides utilization
Effector:
Regulog: RhmR - Chloroflexia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Chloroflexus sp. Y-400-fl
Chy400_0391 rhmE -177 5.7 CATACCGATCGATGCCCAGG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD