Regulog RhmR - Chloroflexia
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Rhamnose oligosaccharides utilization |
| Effector: | |
| Phylum: | Chloroflexi |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Chloroflexi
- By TF family - LacI
- By pathway - Rhamnose oligosaccharides utilization
| Genome | Genes | Operons |
|---|---|---|
| Chloroflexus aggregans DSM 9485 | ||
| Chloroflexus sp. Y-400-fl | 5 | 1 |
| Herpetosiphon aurantiacus ATCC 23779 | ||
| Roseiflexus castenholzii DSM 13941 | ||
| Roseiflexus sp. RS-1 |
| Genes | Function | |||||
|---|---|---|---|---|---|---|
| CRON 1. | ||||||
| rhmE |
|
*
Chloroflexus sp. Y-400-fl Site: position = -177 score = 5.6567 sequence = CATACCGATCGATGCCCAGG Gene: Chy400_0391: Predicted rhamnose oligosaccharide ABC transporter, extracellular solute-binding component |
|
|
|
Predicted rhamnose oligosaccharide ABC transporter, extracellular solute-binding component |
| rhmF |
|
Gene: Chy400_0390: Predicted rhamnose oligosaccharide ABC transporter, inner membrane component |
|
|
|
Predicted rhamnose oligosaccharide ABC transporter, inner membrane component |
| rhmG |
|
Gene: Chy400_0389: Predicted rhamnose oligosaccharide ABC transporter, inner membrane component |
|
|
|
Predicted rhamnose oligosaccharide ABC transporter, inner membrane component |
| rhmA |
|
Gene: Chy400_0388: alpha-L-rhamnosidase |
|
|
|
alpha-L-rhamnosidase |
| GH1 |
|
Gene: Chy400_0387: glycoside hydrolase family 1 |
|
|
|
glycoside hydrolase family 1 |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |