Regulog RhmR - Chloroflexia

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Rhamnose oligosaccharides utilization
Effector:
Phylum:	Chloroflexi
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - LacI
By pathway - Rhamnose oligosaccharides utilization

Statistics of regulated genes
Genome	Genes	Operons
Chloroflexus aggregans DSM 9485
Chloroflexus sp. Y-400-fl	5	1
Herpetosiphon aurantiacus ATCC 23779
Roseiflexus castenholzii DSM 13941
Roseiflexus sp. RS-1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes						Function

CRON 1.
rhmE	Chloroflexus aggregans DSM 9485	* Chloroflexus sp. Y-400-fl Site: position = -177 score = 5.6567 sequence = CATACCGATCGATGCCCAGG Gene: Chy400_0391: Predicted rhamnose oligosaccharide ABC transporter, extracellular solute-binding component	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	Predicted rhamnose oligosaccharide ABC transporter, extracellular solute-binding component
rhmF	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl Gene: Chy400_0390: Predicted rhamnose oligosaccharide ABC transporter, inner membrane component	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	Predicted rhamnose oligosaccharide ABC transporter, inner membrane component
rhmG	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl Gene: Chy400_0389: Predicted rhamnose oligosaccharide ABC transporter, inner membrane component	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	Predicted rhamnose oligosaccharide ABC transporter, inner membrane component
rhmA	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl Gene: Chy400_0388: alpha-L-rhamnosidase	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	alpha-L-rhamnosidase
GH1	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl Gene: Chy400_0387: glycoside hydrolase family 1	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	glycoside hydrolase family 1

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog RhmR - Chloroflexia

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --