Regulon of IolR in Streptomyces scabiei 87.22

Properties
Regulator type:	Transcription factor
TF locus tag:	SCAB_19101
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Inositol utilization
Effector:
Regulog:	IolR - Streptomycetaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By TF family - LacI
By pathway - Inositol utilization

Regulated operons
	Locus Tag	Name	Function
Position: -111 Score: 5.4 Sequence: GGCCTGGACCGTTCCACAGC Position: -29 Score: 6.6 Sequence: CGTTTGGAACGGTCCAAAAG Locus tag: SCAB_19091 Name: iolG Funciton: Myo-inositol 2-dehydrogenase (EC 1.1.1.18)
	SCAB_19091	iolG	Myo-inositol 2-dehydrogenase (EC 1.1.1.18)
Position: -102 Score: 6.6 Sequence: CTTTTGGACCGTTCCAAACG Position: -20 Score: 5.4 Sequence: GCTGTGGAACGGTCCAGGCC Locus tag: SCAB_19101 Name: iolR Funciton: Inositol utilization transcriptional regulator IolR, LacI family
	SCAB_19101	iolR	Inositol utilization transcriptional regulator IolR, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD