Regulog IolR - Streptomycetaceae

Member of regulog collections
- By taxonomy - Streptomycetaceae
- By TF family - LacI
- By pathway - Inositol utilization
Genome | Genes | Operons |
---|---|---|
Streptomyces avermitilis MA-4680 | 2 | 2 |
Streptomyces coelicolor A3(2) | ||
Streptomyces griseus subsp. griseus NBRC 13350 | ||
Streptomyces scabiei 87.22 | 2 | 2 |
Genes | Function | ||||
---|---|---|---|---|---|
CRON 1. | |||||
iolR |
*
Streptomyces avermitilis MA-4680 Site: position = -135 score = 6.20347 sequence = TCTTTGGACCGGTCCAAAAT Site: position = -20 score = 5.91326 sequence = GATGTGGAACGGTCCAAGAG Gene: SAV_7156: Inositol utilization transcriptional regulator IolR, LacI family |
|
|
*
Streptomyces scabiei 87.22 Site: position = -102 score = 6.59248 sequence = CTTTTGGACCGTTCCAAACG Site: position = -20 score = 5.39801 sequence = GCTGTGGAACGGTCCAGGCC Gene: SCAB_19101: Inositol utilization transcriptional regulator IolR, LacI family |
Inositol utilization transcriptional regulator IolR, LacI family |
CRON 2. | |||||
iolG |
*
Streptomyces avermitilis MA-4680 Site: position = -29 score = 6.20347 sequence = ATTTTGGACCGGTCCAAAGA Site: position = -144 score = 5.91326 sequence = CTCTTGGACCGTTCCACATC Gene: SAV_7155: Myo-inositol 2-dehydrogenase (EC 1.1.1.18) |
Gene: SCO6988: Myo-inositol 2-dehydrogenase (EC 1.1.1.18) |
|
*
Streptomyces scabiei 87.22 Site: position = -29 score = 6.59248 sequence = CGTTTGGAACGGTCCAAAAG Site: position = -111 score = 5.39801 sequence = GGCCTGGACCGTTCCACAGC Gene: SCAB_19091: Myo-inositol 2-dehydrogenase (EC 1.1.1.18) |
Myo-inositol 2-dehydrogenase (EC 1.1.1.18) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |