Regulon of ScrR in Ralstonia solanacearum GMI1000

Properties
Regulator type:	Transcription factor
TF locus tag:	RSp1286
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose-6-phosphate
Regulog:	ScrR - Ralstonia
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By TF family - LacI
By effector - Sucrose-6-phosphate
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: 7 Score: 6.3 Sequence: GCATGGTATCGATCCCACAA Locus tag: RSp1286 Name: scrR Funciton: Sucrose utilization regulator ScrR, LacI family
	RSp1286	scrR	Sucrose utilization regulator ScrR, LacI family
Position: -45 Score: 6.7 Sequence: ATGTGGTATCGATACCATGT Locus tag: RSp1285 Name: scrA Funciton: PTS system, sucrose-specific IIBC component (EC 2.7.1.69) Locus tag: RSp1284 Name: scrB Funciton: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) Locus tag: RS05328 Name: scrO Funciton: Predicted sucrose-specific porin Locus tag: RS05327 Name: scrC Funciton: PTS system, sucrose-specific IIA component and PEP phosphotransferas (EC 2.7.1.69)
	RSp1285	scrA	PTS system, sucrose-specific IIBC component (EC 2.7.1.69)
	RSp1284	scrB	Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
	RS05328	scrO	Predicted sucrose-specific porin
	RS05327	scrC	PTS system, sucrose-specific IIA component and PEP phosphotransferas (EC 2.7.1.69)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD