Regulog ScrR - Ralstonia
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sucrose utilization |
| Effector: | Sucrose-6-phosphate |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Ralstonia
- By TF family - LacI
- By effector - Sucrose-6-phosphate
- By pathway - Sucrose utilization
| Genome | Genes | Operons |
|---|---|---|
| Cupriavidus taiwanensis | ||
| Ralstonia eutropha H16 | ||
| Ralstonia eutropha JMP134 | ||
| Ralstonia metallidurans CH34 | ||
| Ralstonia pickettii 12J | ||
| Ralstonia solanacearum GMI1000 | 5 | 2 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| scrR |
|
|
|
|
|
*
Ralstonia solanacearum GMI1000 Site: position = 7 score = 6.2986 sequence = GCATGGTATCGATCCCACAA Gene: RSp1286: Sucrose utilization regulator ScrR, LacI family |
Sucrose utilization regulator ScrR, LacI family |
| CRON 2. | |||||||
| scrA |
|
|
|
|
|
*
Ralstonia solanacearum GMI1000 Site: position = -45 score = 6.72779 sequence = ATGTGGTATCGATACCATGT Gene: RSp1285: PTS system, sucrose-specific IIBC component (EC 2.7.1.69) |
PTS system, sucrose-specific IIBC component (EC 2.7.1.69) |
| scrB |
|
|
|
|
|
Gene: RSp1284: Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
Sucrose-6-phosphate hydrolase (EC 3.2.1.26) |
| scrO |
|
|
|
|
|
Gene: RS05328: Predicted sucrose-specific porin |
Predicted sucrose-specific porin |
| scrC |
|
|
|
|
|
Gene: RS05327: PTS system, sucrose-specific IIA component and PEP phosphotransferas (EC 2.7.1.69) |
PTS system, sucrose-specific IIA component and PEP phosphotransferas (EC 2.7.1.69) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |