Regulog ScrR - Ralstonia

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose-6-phosphate
Phylum:	Proteobacteria/beta
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By TF family - LacI
By effector - Sucrose-6-phosphate
By pathway - Sucrose utilization

Statistics of regulated genes
Genome	Genes	Operons
Cupriavidus taiwanensis
Ralstonia eutropha H16
Ralstonia eutropha JMP134
Ralstonia metallidurans CH34
Ralstonia pickettii 12J
Ralstonia solanacearum GMI1000	5	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes							Function

CRON 1.
scrR	Cupriavidus taiwanensis	Ralstonia eutropha H16	Ralstonia eutropha JMP134	Ralstonia metallidurans CH34	Ralstonia pickettii 12J	* Ralstonia solanacearum GMI1000 Site: position = 7 score = 6.2986 sequence = GCATGGTATCGATCCCACAA Gene: RSp1286: Sucrose utilization regulator ScrR, LacI family	Sucrose utilization regulator ScrR, LacI family

CRON 2.
scrA	Cupriavidus taiwanensis	Ralstonia eutropha H16	Ralstonia eutropha JMP134	Ralstonia metallidurans CH34	Ralstonia pickettii 12J	* Ralstonia solanacearum GMI1000 Site: position = -45 score = 6.72779 sequence = ATGTGGTATCGATACCATGT Gene: RSp1285: PTS system, sucrose-specific IIBC component (EC 2.7.1.69)	PTS system, sucrose-specific IIBC component (EC 2.7.1.69)
scrB	Cupriavidus taiwanensis	Ralstonia eutropha H16	Ralstonia eutropha JMP134	Ralstonia metallidurans CH34	Ralstonia pickettii 12J	Ralstonia solanacearum GMI1000 Gene: RSp1284: Sucrose-6-phosphate hydrolase (EC 3.2.1.26)	Sucrose-6-phosphate hydrolase (EC 3.2.1.26)
scrO	Cupriavidus taiwanensis	Ralstonia eutropha H16	Ralstonia eutropha JMP134	Ralstonia metallidurans CH34	Ralstonia pickettii 12J	Ralstonia solanacearum GMI1000 Gene: RS05328: Predicted sucrose-specific porin	Predicted sucrose-specific porin
scrC	Cupriavidus taiwanensis	Ralstonia eutropha H16	Ralstonia eutropha JMP134	Ralstonia metallidurans CH34	Ralstonia pickettii 12J	Ralstonia solanacearum GMI1000 Gene: RS05327: PTS system, sucrose-specific IIA component and PEP phosphotransferas (EC 2.7.1.69)	PTS system, sucrose-specific IIA component and PEP phosphotransferas (EC 2.7.1.69)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog ScrR - Ralstonia

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --