Profile of regulator ScrR in Ralstonia
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sucrose utilization |
| Effector: | Sucrose-6-phosphate |
| Regulog: | ScrR - Ralstonia |
Member of regulog collections
- By taxonomy - Ralstonia
- By TF family - LacI
- By effector - Sucrose-6-phosphate
- By pathway - Sucrose utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Ralstonia solanacearum GMI1000 | |||||
| RSp1285 | scrA | -45 | 6.7 | ATGTGGTATCGATACCATGT | |
| RSp1286 | scrR | 7 | 6.3 | GCATGGTATCGATCCCACAA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |